Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ599246
Length 837 bp
Fasta Format > rwhv16n19g03
catcggacggcagccctttcgggggttccttagggaccgattcactctgc gtagattgactgaacgcagaaagccttccactggcaggcgatcgtgtttt tcacaggatttctcgttactcatgtcagcattctcacttctgatatctcc aggtcttgtcaccaaaaaccttccccgattgacagaacgtcccgctactg acacttgaaaaagctgctttcaaggtctcgtcgcttcggtgaatcacttg agccctgagacattttcggtgccatggagctagaccagtgagctattacg ctttcttcaaaggatggctgcttccaagcccacctcctggttgtcatcgc tcgatcacttccttttccactaagtgattgcttagggaccttagcgtacg atctgggctgtttccctctcgactttggatcttagcacccaatcagtctg tctgtactaaggatgacggcctgtattcggagtttccctggggttggtaa agcgaaatgggggccaccctagcccattgagtgctctacctcgggccatc gacatcatacgctctactgaaatagatttcgcggaaaaccagctatatcc gatcttggttggcctttcacccctagccacaagtcatccccgtattttgc cacatacgtgggttcggtcctccaaggcctgttanagctctcttcaacct gctcatggctagatcgatcggnttcgggtcaaatangaanaacgtaaatc ttccacctctggaaagcgcctacacctaatggcttaanccgctgttccca tttcctcnntgacccatcatgcnaaaggnacnccnnt
Download
page-top