Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ599190
Length 349 bp
Fasta Format > rwhv16n19c15
ggactctcctatanaaatgatcttcnggntnatatctaccatcctgtcta gcttcctcttgaaacacaccacgcctgcctcatctctcggagcaggagga ggagcttgcaggaacaatggcagcccagggtcttctctctgggaggcagc tgctggggaggcctctgcagtcctccatctccaggtcgtcttcctcccgg aagtcccccttcntcntcanggcatcntccancccccctgccnancnaaa tgacaacangcanctgtggttcncntccnancannccctcnnctacctcn acnnnncnctncccnnngantttnnntncnanccnntnnnnntnnnnna
Download
page-top