Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ599162
Length 631 bp
Fasta Format > rwhv16n19a21
cgtacagcagagttttggacaaaagtgaagttcacaaaagaccttcatac gagataggccattgtttcaactcgctagtttaggccttgccggactcctc gcaacccggtggcctaaaggcgatgaagctgacgcactgcacctggcgca ggttgtcgaagccgatgacacggacataggcgtcagggtactccttcttg acctcctccacctcgttcagcacctgtgtggcgtcagtgcacccgaacat aggcagcttccacattgtccagtatcggccgtcgtagtacccgggggagc tgttgtgctcacggaagacgaagccaaccttgctgaactcgaggcagggc acccactttgagcggatcaggtagtcgacctgtttcaggagggcctccgt ggataggggtggcaggtaagacagggtctcgaacttcttgatgccctcaa ttggccacacctgcatgcacctgatccttccgccattgctgacgctgctg aggctgccgctggagcggcggccgacggggagaccggctgtggacttgag cccctggaagggtgcgacggtggtanccgaggaagccatcacggcggggg ccatggtaatgtattatctggagganaggan
Download
page-top