Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ598083
Length 553 bp
Fasta Format > rwhv16n14p20
tttgtctagatcatacacactttgtttattccattacgttgtagtcaact cgtaagtaacatcgtgcaaaccgccatgactctctcaacaacaatatctt ggagttttcaaaggtcacggcggcatcatctgtgcgtggtcatcaagcga cggtgttggccggggtcacctccggtgcaggcgcggcgtctgctgccggg gttgcctcaggtgcaggcacggcgtcggctgccggggtagcctccggtac agtagtggcttcggcctcccagaaggcggtcttcttcccggtcttggaga ccgtctggaaaacgtcttctggcttgacgttgcccttcacggtcaccttc tgctgctccatgtctatgtcgaagctctcgacgccttccattttggtgag cacccttttaaccgcccccgagcaacctccgcaggacattgccaccttga ggacaacagtctcggaggccatggctggcagctacancaggagtcangag ganaagatcgggagacggggatcgatgtcntcggaggganantttgatga tgc
Download
page-top