Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ597847
Length 419 bp
Fasta Format > rwhv16n14b19
catngatgatnncaagaagtggtcgatcaacgaatcttagaacagtccac agatgagctgatggcgtaggggacgctgacgccgcactttgaagggatgc cggcggccttgccagcgttgagcccaccagcagcgctcttgatgcacttg cacgctgcttgcttgtcggcggtgctccgggctgcaccggccanactcct gacgccgctgcancangccgcangcgggttggcnacattgccgcntgcat anganatgcangggctcaangcanangtcncctgaccncangatatcncc ncatcncangctannangancntancnnncnccntnnnnaccnnnncnan ntnannanctnnncnnnnanncntnnntattnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnna
Download
page-top