Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ223117
Length 476 bp
Fasta Format > whdl2p01
aaatgaaactgcaaatgggtatcaaatgtttcacaatctctgacgtcacg gcggcagaaggatttcaagtactctaaaacatttagctagaagggactaa accattgatcataaccaccaacaaaaatattttccttgtttacagaacac catcgcacttcgcacttctgtttcaaacagattactttgaggtcgtcttg tccttggtcttctgtattttcaacaccttcttcacgatcttctgctcctc aaccaagaaagcgcggatgatcctttccctcactgcagttccagagagca ctccatcatagggacggttcacagtcctgcggttcctagacaaccttgat cttttgtattcagtaggcctgnggtggggaatcccctggatcttcttccc ggtcacagggcacttggggccgctcgccctcttcttggngtactggtaca ctancttaccacctggngtcttgacg
Download
page-top