Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ597475
Length 888 bp
Fasta Format > rwhv16n12j01
tattatgacgatacagatttagtcagacatgcactagaaccgttacaact gtactgaaatacaactacctttacagtcatagtacacattgctattttac aggaaatacaactctgtcttcagttatttgtatgtggcacttaatcgttc tttcaaatagtcacccgccgtgataggtggaaaccttggaggatatgcgt cgcagcaacagctttccaagcactgcaccactagatcgggtcttgggtcc agaaagtaagccgcagaatatcgctctctgccaactgcaacaacccgatg aagtgtagatctgaaaacacaatttgtccacctttctagcaaatcgccaa tgttaacaataagggtcccatcaacatgacgaacatcttcccagagctgg ggatgcctatccttctccctgcatatctgcaagccaggagtgccatctgt tgctagaagagttatcattccataatctgaatgagctgatgcaccataat ttccatgatcagactcgtttacttcacctgggtagtgcaatagccgaata acttctgaagagcagttgactgcaccaatcttctgaaagaattcagcttc taggtccagactcagagcaattagagagagtatccttttgccagcagcca gtgcagcttcatggtacagcttcattgtatccttccaagatggaaagcgc tctttaggaggccattggttaggatcattcggcatatctacatccctgac cgccccaatgtagaaactctccttgaggtctccctggaattcggacgact cgtccagcttctcggcgtanggcgggggtgtanccccggtggctgctgtt cctctgcagcagcatctcctcgtgnccgaattcctgca
Download
page-top