Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ597297
Length 167 bp
Fasta Format > rwhv16n11n22
ggatggctgcttccaagcccacctcctggttgtcatcgctcgatcacttc cttttccactaagtgattgcttagggaccttagcgtacgatctgggctgt ttccctctcgactttggatcttagcacccaatcagtctgnctgnactaag gatgacggcctgtattc
Download
page-top