Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ597278
Length 819 bp
Fasta Format > rwhv16n11l17
acccactgacagataactaacctccagttacaactttattgttcccatat acgacatggctttctcccagatacaacattatagctcccagattacgaca ttgttcctcccggatacgacattgtcgctcctacgacatggtttctctca gttacgacattgccgctaccagatacgacattgttgctcccggttacaac attgtcattcccggatatgacggtgttgtcgttcccagatagaacattgt tgctcccagatctgatagtgttgcggcttccagatatgacatttggttgt tggccgagtatgcgcctgctacgcttctcatacaagggcatgttagtgaa agccatacccggtgaatggcccacaacggtggtgaggcccttgagtcgtg tcgaactcttgggtaccttgccagtcattgaattatttgagagatccaag tagtgaaggtggtcaagctcaccaatccaggacgggatggtgccgaccaa tctgttgttggcaaggctgagcgaccttagctcgccgcaatcggcaaggc taactggcagcaacccattcaggtagtttgcgctcaagtcaaccaaagca agaagcggcatgccagagaagttgacgtgagaaatcggaccanacagaga gttattccggaggttgagctcacggagagatgacagtgatgacagggacg gtggcagtgatccnaanaagccattggagtgtgcaaccaaatgctcnagc gacntgaggtcatggaacatgttgtcanggaggtggccggaanaancngn tgatggacaaatccaacaa
Download
page-top