Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ597014
Length 356 bp
Fasta Format > rwhv16n10k04
caggctccagtagccttggcttagcagtgagctgagaagcataantgacc ctccgggctgttgggatgacctgaccaccacccctgtgaatagcatcagt gtgcanaacaacatcacagacctcaaagcanatgccacncatgttctcct canccaatgcaccttccttcgatgcccactggaacccagccacaacagag tccttgatttcattcagatactgcactcccttacacatgtcgacaaccat gttgggcggacaagaacctcatcaggctgctgatctgcatgggggaggcg atgaggacgatcgccttcaggtcaggacggcgtcctgcggcggcacggcc tgcgtc
Download
page-top