Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ601687
Length 575 bp
Fasta Format > rwhv16n8o10
agcatgcacgcagcacgcgtacaaatttacattttacacccaccctcgca tatatacctctcgcacgctcacgtttcccacgacgacgggtaccatgcac aggacgacgatgctcggatcggatcggatcgatttcgcctagtggaactt gaggctggtgaggatgttgttgttgacggggtctgagaggtggtcgagga ggttctggaagggcccgacgccggtgaagatggcctgcagggacatgccg aggaaggcgagcatggcgaggcggccgttcttgatctccttgagcttgag ctccttcatctccttctcgctcttggtcccgaacccgagcgggttgaaga tgggcccgccggggtaggcggggtcgccggagccgccgaggtacttctca aggcccaggaagtactgcttccccatggagcccgggttgtaccagtcctg gagccgccggtgctccgcgaagccgatgagcgccatctcgaacacgaaga gcgtgtatgggtcggcccantactggtangtgcccgccggcggcctcntg ccnaattcnnnacnangcctcntnc
Download
page-top