Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ601088
Length 648 bp
Fasta Format > rwhv16n6i11
aaactcatgtagtcctctcaaaagggtgaaggaacaaccaaacatcaata caacagtgtggcctgccatgcagagctggccggacgtaggtactcctctc gctgtcacgcagtgagataatatgagagcacttattcatatatatgtata tgtatgtgtatgacctcaacgtactcagcgtagatcgctggagctatatg cagcgatgatgagaagaagtggtcgatcaacgaatcttagaacagtccac agatgagctgatggcgtaggggacgctgacgccgcactttgaagggatgc cggcggccttgccagcgttgagcccaccagcagcgctcttgatgcacttg cacgctgcttgcttgtcagcggtgctccgggctgcaccggccagactcct gacgccgctgcagcaggccgcaggcgggttggcgccattgccgcgtgcat aggagatgcaggggctcaaggcagaggtcacctgaccgcaggatatcgcc gcatcgcaggctacgaggagcatagcggccaccatggagaccagcacgag ctgagtagctgcaccgcgagccatccctattgagtttgcagtagtagtgg tgttgagctcagctggagatggtgagatgggctagatttgctaagtga
Download
page-top