Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600919
Length 627 bp
Fasta Format > rwhv16n5m16
tcattattcacaccccgnctgcacatgggaaaaacattatttggatccac aagacacgatccaactccaagcaggaacgcgatgccaagcgcgtacgtga ttcatcgattaacttaggtggtgtagtccttgaggatgtcgagggtgagc tcgctggcgtcggtggcctgcacgtcgatctgcacgccgtccagctcctt cttgagcccctccgtggagctggcgtacagcatcttgttcctcgcgtccg ccgactccggcgaccagtggatgaagaagatcttgctgcggggggtctcg ccggccgagtcctcggacacgaagtccaggtcgtagacggcgtagcggca gtcgtcggcgggcatggccgccgccaggtcgtcgaaggtggcgtcgagcg cgcccaccttgtccaccaccacctgctgcgcgtcgtcgtccatcttgtac accacgaaccggtgcttgcggtccgcccgcagctcctggaacgccttcac gcactcctcgttcaccgccactccggacacagagttcgccattgttgatg gatctggaggttggcccgaggaaaaaatctgtgtgctaaactggaactgg tagctanattgaaagctgatggttggc
Download
page-top