Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600813
Length 667 bp
Fasta Format > rwhv16n5e22
gntacaaagtacaacaaactcccgtctctgctcaaagggagtgaacgaac aatcaaacgctgatacaaaatagatacaacagtggccggctatgcagagc tggctcgacgtacgtactcctgtctctcacatggagatcatatcagagca tttattcatgtatatgtgtatatatatatatatatatgtgtgtgtgtgac ctcaacgtactcggcatctatcgctggagctataatcggcgatgatggcg gcaagtaatcgatcagtggatcttagagcagtccacggatgcgctgatgg agtaggggatgctgacgccgcacttggaggggatacttgcagcctttccg gggttgagcccaccggcagcactcttgatgcacctgcatgccgcttgctt gtcggcggtgctccgcgctaagccggccaatctcctaactccggaacagc aggccccaggcgggctggccccgctgccttttgcgtangagacgcaggag gccagggcagagttcacctgaccgcangagatcgccgcgtcggaggctac cangagcattgccgccaccagggcgaccagcacgagctttgttgctgcag tgcgagccatctcgaccgagttanctgtanttgtggtggagggctcncan ggagagggtgggtaatt
Download
page-top