Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600682
Length 808 bp
Fasta Format > rwhv16n4m20
aacattctcagcttcaacctaggactcgaacagtttacagaaaatggtga ttcanatatgtctgcaaacatgacatggacgcaacatctaaganaatcca acaagataacatgcancagctcttcancctaagctgtggcacccttgccc ttcttcttctggagcttccacatgtanaactccanctccttgccctccag gatgtaccnatcagctctgnnncactgtncagggcgagangaaatgcagg ccancagccttccaccgctgaactgctcctcaatgtgagagtccagtgna cgtncctgctgncgcttntcaagcttnctctggacattgttgctcttctt tgcttcctctgtggcancagcagcaacctnagactcttgtncctcagnag catncttcttggcagctgcagcagctttcntcttcctaccgatttccact ccataatgagtcaggtaccactgcttgaaaggggcagcatcaacttgcnc aatggcattcttgacaagggtctgagtcctcacaagctcattgtttgacg aattgtaaaccacatccaggagacgggncttgcgggtcacagcctcacta ccccatgagaagttaccagtgtccagacggagagccctccacttcacgtt acctccgcgaacacggaccctcctcactgtcttgttgctcgaaagcttag tgttggctggctggcggccgagctcatactttcgcttcttcctccacgcc ttctgcttcccaccggtggcccggcgcttgtgcatggagtcacgcnagat acccatgg
Download
page-top