Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600542
Length 579 bp
Fasta Format > rwhv16n4e19
atactcggtaagcgggacgcccaaacgggccacagcaccgaaggcagatc aatcagtacttgtagtccttgacgtggaggctctcggaggcgccctcagc gagggtctcctcactctgtccaccagagaggaagacaatggcggggacgg cagcagggacggtcctctggagggtgcggacggtgtactcagcaatcacc tcaggggccaccttcttggagtcagaaccaggggtgaccatgttgggctt caggagagtgccctcgaggaggacatgctggtcgttgagggccttatagc aggcagcaaggacgatctcggtgacgtaagcacagcggtcaatgtcatga ggtccatcaacaaggatctcaggctccacaatgggcaccagaccattctc ctggcagatgatggcatagcgagccagaccctgagcgttctggtcgatgg agagctgcgatggctcggtggcgccgatcttgaggactgcacgccacttg gcgaagcgggcaccagcctcatagtacttggcgcancgcttgcnaaggtc atcaaagccctgggtggtggnctcaccga
Download
page-top