Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600271
Length 512 bp
Fasta Format > rwhv16n3d10
cnaaagattgccaaactaccaacggctgaattattctgaatgtacngata agnacnagcactaaaccataataggtgaatctattctctcggaagcngtt tacatcttggaggcagccancacaaccaacngtnaagcacccttccaggt gctttagtttccagccaatgatcatcatgaacctaatgttggggcggctt cctnaacagatagataaccactcatggagcaatacccattgccgaaaatt gcctgatcttcagnttcaggtgtccncattatggtactggggttgcatat aacccatcccttgggcgnangctccatgctgaaccatcgcttgggcgttt gagctantcgcaccnctatgagcacnaattatatctntcttnacggatcc ttcaccagattntgaggtcnatttactatcaccctccatatctctgtact tttgcangtagatcttgagggggtctacgtactcctngaatccgagngtg gccatggcccag
Download
page-top