Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600213
Length 837 bp
Fasta Format > rwhv16n2p15
ttctctgttcatacaaaaaatagaaaaacatctcgaaaatgtttaacaat tgctaactatgtgtttgatacatctcatctttcctttgattttgctaata tgactcttgatatagctcctcttgtcattgtgagtggtgtcttttaggag ctgtcagcactttttcatgtctataggcggaactccttgacacgcttctt ctcgtcatccaaagtgttgtagtggctgaacatgagatcaacagcatatc ggatccttgcatctgggacattttttggtgaaaaaactataggggttgga ttccttgggcaccatcccattagtttcatagtgaaaatgccacaatcaat atcgttatcttgttgagggactttagggtaaacagtagggaatgcactga aatccattggctggagccgagcttcgtaccaagtgcatataaagcttgag ataatcttcttttttatgttcatatgatatgagctattctcatcatagaa agaatccaaaaaataaaatgtgcgacccttgatgtcgacgacgaacagaa agtaatattcctcgtgtagtgttggaaagtacaacttgtctgacatcaaa agattatgtgcttttccagctccaatgaaacttctaatcagtttcttcct ccaccaaattcttgcctcatcatttttccatttgcccaggaaatattcag atgcagtatggaagaaatagtgcttgagtgagttcctaggatgattttca ttaaataggtgcctgcagtacacatttatgacatangcctggacccggcc acctattttcttcnagttacccaactgtccaaatgtg
Download
page-top