Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ600166
Length 848 bp
Fasta Format > rwhv16n2m22
gttccagctttttacatacatacagtccatagcgttcttcgtctactgtg aatacagaggagcaaaaaggatggcatctctgcaagaagcatatttgcac agcaaatttgcaaaaacacagagagcattgagcagaggggtctttttgtt ttctcttctttctccacttgcaaatcaagtcttttttgcaactctatata acctacaaaccgcagcttaaaaaccgtaccgctgtcagtcacgtttcact cgtctcccattgcaagctctagcgcgtaatcatctctgtcaacaggcccc cgcgcaaagtatcttccaaactggagccaatatacctacaaattgagata gacgcgcaatcatcggaattcagaagaatatttcatactagttcctatag catatttgaactagaaattcattaggcgtcttaagagaattgcttgcctc atcttcatcttgcgtttcaacttcaagatcagaggatgggtaaccaacac ataacaaagcatagccctgaaaaggaagccatacaattgcaacatcaaca tgatttcagtttgcagaggtagaatcataatgattcacgaagcctataac atatgtcctcgtcctgtataggaagcacacatagcgcacccgattcgtgt gataaaactgaaagaagttggcaattctagagtaccagacagagttgaag tcgaccttgatccgtcctaacaagtcactgctcaccaactcatctctaca tcagttgtcttggtaataaaaacaataggttactgcgacgtgtaataaag cttgggtccaacagttgcactgatcaccatgcaatgcaaatgataaaa
Download
page-top