Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ599543
Length 590 bp
Fasta Format > rwhv16n1h14
aagctgaagcagtggtccgatactcccatcagaaatcagaacgatcatgt ttcttctgcccttgataatttacacgtacggcacattcgtactctcatac ttttccccggtaaaattcacacagcacatgatgctgcatcgcgcgcatcg cacgcagctgatccatcaacagccgacggcggcggacgggcaatcaacgg ccagctcacaggctgggcaccctctcggcggcgccggagatgacggtgag caggttgttgccgaaggggtcgctgaggtgcgcgcacaggttctcaaagg ggccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaac atggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctg gtcggggtcggtggcgaggccgagcgggtcgaatgggccaccggggtgga gcttgtcatcaaattccagtccgttggtgatcctgtantactcggcgcct ccgacnangacnacctcngcgacnacngnnangatcangttgatggggat gctgttgncnaannannnnangnngnnnnnnnnnnnnana
Download
page-top