Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ599497
Length 846 bp
Fasta Format > rwhv16n1e21
aaaagagtttgttttgccaacaaaccatttgatatcttgggtgtacattt tacattgccaacaaactgcacaaatagtgccacccactacgaaaataaac atcatttatttagtttaccgtacaactgcgccttttattttactacaaaa acaaataatgatacactagtccaggtctagcttttcagccgcatagaaag aggaacaggggtaataacaaatcatgagcttgtaaagtgtgcaatcgatt gtgccatcatcaaagcagaccttttgcacaaccatatgcacagtaatagg gggcgattaaaagatcggcacaacgctgtcgtggaccctgttcttctggt tctgggcaacgcattccgagatccacatcaagttccttatctcctgctct cgtagcctcatgtatgcgaagaaaacagcgtagtggaactgctgttcaaa tgactggcacagcctctttacttcctcctcataaaaggccttgtccaaca tctggctttcgccatatgatatcttggcaaaaatagactggtatgggggg tacttttccattacaccacgcacctggtcaacatcttcacagacagccaa ctcttcatgaccatacggaaacaatagaccaaagttggagtacagcttcc ggcggtcatctctagtcagctcagtaccaatactgtttatggtaatgttt acagctcttctgtcagcttcaaatgaaaggagattacacataatctcagc cgtcgcaccacctagtttcgcacaaaatttgtaaaaatcctcaagatacg ctttgtagagtgtgttccctcatgatctcaatattcatgtcatcca
Download
page-top