Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ704350
Length 710 bp
Fasta Format > whv16n17j02
caccctctccctgcgagccctccaccacaactacagctaactcggtcgag atggctcgcactgcagcaacaaagctcgtgctggtcgccctggtggcggc aatgctcctggtagcctccgacgcggcgatctcctgcggtcaggtgaact ctgccctggcctcctgcgtctcctacgcaaaaggcagcggggccagcccg cctggggcctgctgttccggagttaggagattggccggcttagcgcggag caccgccgacaagcaagcggcatgcaggtgcatcaagagtgctgccggtg ggctcaaccccggaaaggctgcaagtatcccctccaagtgcggcgtcagc atcccctactccatcagcgcatccgtggactgctctaagatccactgatc gattacttgccgccatcatcgccgattatagctccagcgatagatgccga gtacgttgaggtcacacacacacatatatatatatatatatacacatata catgaataaatgctctgatatgatctccatgtgagagacaggagtacgta cgtcgagccanctctgcatagccggccactgttgtatctattttgtatca gcgtttgattgttcgttcactccctttgagcanagacgggagtttgttgt actttgtaccatgtgcactcatggtattataaattaatctagctctattc aaaaaaaaaa
Download
page-top