Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ704090
Length 694 bp
Fasta Format > whv16n16h16
atccggcgtcaactgatcggcggcagccatgagtaagctccaaagtgacg ctgttaaggatgccatcacccagattgttggggaggcgagagaaaagaag cgcaagttcactgagactgtggagcttcagatcggtctcaaaaactacga cccacaaaaggacaaacgtttcagcggctcagtgaagctgccccatatcc cccgcccaaagatgagggtgtgcatgcttggtgatgcccagcatgtcgac caggctgagaaaatgggacttgactacatggatgttgaaagtctcaagaa gatgaacaagaacaagaagcttgttaagaagctagccaagaagtaccatg ctttcttggcatcagaggccataatcaagcagatccctcgtctccttggc cctggtcttaacaaggcaggcaagtttcccactctggttagtcaccagga atctcttgaagccaaggtcaacgagacaaaagctacagtcaagttccagc taaagaaggttctttgcatgggtgttgctgtgggcaacttgtcgatggac gagaagcagatccaacaaaacatccaaatgagtgtcaacttccttgtgtc cctcctgaagaagaattggcagaatgtgaggtgcctgtacgtgaagagca ccatggggaagcgtgtacgggtgttctaagtgtgtgcgctccag
Download
page-top