Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ703999
Length 584 bp
Fasta Format > whv16n16b01
actctccctccgacgacatcgatccccgtctcccgatcttctcctcctga ctcctgctgtanctgccagccatggcctccgagactgttgtcctcaaggt ggcaatgtcctgcggaggttgctcgggggcggttaaaagggtgctcacca aaatggaaggcgtcgagagcttcgacatagacatggagcagcagaaggtg accgtgaagggcaacgtcaagccagaagacgttttccagacggtctccaa gaccgggaagaagaccgccttctgggaggccgaagccactcctgtaccgg aggctaccccggcagccgacgccgtgcctgcacctgaggcaaccccggca gcagacgccgcgcctgcaccggaggtgaccccggccaacaccgtcgcttg atgaccacgcacagatgatgccgccgtgacctttgaaaactccaagatat tgttgttgagagagtcatggcggtttgcacgatgttacttacgagttgac tacaacgtaatggaataaacaaagtgtgtatgatctagacaaatgaacac gtcgaccacatgatttacaataatanaaaaaaaa
Download
page-top