Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ704802
Length 819 bp
Fasta Format > whv16n19g03
aatccgaagcggtttcattcgatttgttgtggattggatgatggaaaaac cagcaagcagcaagcgtagttagaaaagttgccgtagcgcgccctacgga gttgtacaaagtcagcaaccgttttggggcgcaagcataggcaacacagg actgatgacggggtggggcgcgcagtgaactggttttctaaaaagattgg aagatccggccaaagaaggtgatagccctgttcattcgttcccatggttc gatccttcccagtaaaacgcggcgtgttcgaatgatgatcgcttttacgc gagaaagggggaccaccctctaagcctaagtattcctcaatgaccgatag cgtacaagtaccgtgagggaaaggtgaaaagaaccccaatcggggagtgc aatagagaacctgagatccgatgcgaacaatcagtcgaaggagcggagcg cgggcgcactcactctaacggcgtacctttcgcatgatgggtcagcgagg aaatgggaacagcggcttaagccattaggtgtaggcgctttccagaggtg gaagatttacgttcttcctatttgacccgaaaccgatcgatctagccatg agcaggttgaagagagctctaacaggccttggaggaccgaacccacgtat gtggcaaaatacggggatgacttgtggctaggggtgaaaggccaaccaag atcggatatagctggttttccgcgaaatctatttcagtanagcgtatgat gtcnatggcccgaggtanagcactcaatgggctanggtggcccccatttc cctttaccaaccccnngga
Download
page-top