Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ704731
Length 365 bp
Fasta Format > whv16n19a21
tcgtcttccgtgagcacaanagctcccccgggtactacgacggccgatac tggacaatgtggaagctgcctatgttcgggtgcactgacgccacacaggt gctgaacgaggtggaggaggtcaagaaggagtaccctgacgcctatgtcc gtgtcatcggcttcgacaacctgcgccaggtgcagtgcgtcagcttcatc gcctttaggccaccgggttgcgaggagtccggcaaggcctaaactacgag ttgaaacaatggcctatctcgtatgaaggtcttttgtgaacttcactttt gtccaaaactctgctgtacgactctgctttctgaccggagcatacctttt gttctaaaaaaaaaa
Download
page-top