Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ703717
Length 811 bp
Fasta Format > whv16n14l06
ggtggggcatctcgtacgggtccagatgcatacgaggttgcactcaaact cgaacatcggagaagcaaaggatgtagttatggccccccgtttgagtggc aggtttatcagtctcttaatggttgttatggcataccatcagtccactac aagggtcgccagggagactactacattctcgtaatggatatgcttggtcc tagcctctgggatgtttggaattcaatgggacaggcgatgtcttctcata tggttgcttgcattgccgttgagtccatatcaatccttgagaagcttcat tccaaaggctttgtccatggagatgtaaagccagaaaactttttgcttgg tcaacctggatcacctgatgagaagaagcttttcctaattgatcttggtt tagcatccaagtggaaaaaagcatcatccagtcagcatgttgaatatgac cagaggccagacatctttaggggaacaattagatatgctagtgtccatgc tcatttaggccgtacaggcagtagaagggatgatttggagtcactagcgt acacccttatttttttaataagaggaagattaccttggcaaggctttcag ggagacaacaagagctttcttgtatgtaagaagaagatggctacctctgc ggatgttctgagttgtttctgtccacctccattcaaacattttcttgaga tggtcactaatatgaaatttgatgaagagccaaattatgcaaaacttatt tctctctttgatagtctgattgaagtgcctgcttcaagacccatcanaat tgatggtgctc
Download
page-top