Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ703526
Length 758 bp
Fasta Format > whv16n13o15
ggccttcgtgccggcgacgcatcattcaaatttctgccctatcaactttc gatggtaggataggggcctaccatggtggtgacgggtgacggagaattag ggttcgattccggagagggagcctgagaaacggctaccacatccaaggaa ggcagcaggcgcgcaaattacccaatcctgacacggggaggtagtgacaa taaataacaataccgggcgcattagtgtctggtaattggaatgagtacaa tctaaatcccttaacgaggatccattggagggcaagtctggtgccagcag ccgcggtaattccagctccaatagcgtatatttaagttgttgcagttaaa aagctcgtagttggaccttgggccgggtcggccggtccgcctcacggcga gcaccgacctactcgacccttcggccggcatcgcgctcctagccttaatt ggccgggtcgtgtttccggcatcgttactttgaagaaattagagtgctca aagcaagccatcgctctggatacattagcatgggataacatcataggatt ccggtcctattgtgttggccttcgggatcggagtaatgattaatagggac agtcgggggcattcgtatttcatantcanaggtgaaattcttggatttat gaaagacgaacaactgcgaaagcatttgccaaggatgttttcattaatca anaacgaaagttgggggctcnaanacgatcanataccgtcctantctcaa ccataaac
Download
page-top