Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ703233
Length 703 bp
Fasta Format > whv16n12k24
gaggaggacggccaacccctgcgctagacgagcctctacaagtattcccc atcaatctgggtcaatcgagggcttctgcggtggctaatttcgggaggta gaagagggaggaggagccatgaacggtggtagcaagcaaacgctgatata cagcttcgtggccaagggctccgtggtgctggccgagcacacggccttct ccggcaacttcagcaccatcgccgtgcagtgcctccagaagctgccctcc aacagcaccaggtccacctactcctgcgatggccacaccttcaacttcct cgttgaccgtggttttgtgtttcttgtggtggccgaagaggcgttgggaa ggagcgtgccgtttgtgttcctagagagggttagggaagacttcatgcag aggtatgggtccagtatcgatgaggagggacaacacccgcttgctgatga tgcggatgaggacgatttcctgtttgaggaccggtttagcatcgcctaca atcttgaccgggaattcgggccaaggttgaaggatcacatgcagtattgt attaatcatccagaggaaattancaagctctctaaggtgaaatcacatct ttcagaggttaaagggatcatgatggacaacatcgagaagatattanatc gtggcgagaagattgaacttttggtgggcaagacccgaaaccttacagtc gca
Download
page-top