Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ703199
Length 811 bp
Fasta Format > whv16n12j01
ctgctgcagaggaacagcagccaccggggctacaccccgccctacgccga gaagctggacgagtcgtccgaattccagggagacctcaaggagagtttct acattggggcggtcagggatgtagatatgccgaatgatcctaaccaatgg cctcctaaagagcgctttccatcttggaaggatacaatgaagctgtacca tgaagctgcactggctgctggcaaaaggatactctctctaattgctctga gtctggacctagaagctgaattctttcagaagattggtgcagtcaactgc tcttcagaagttattcggctattgcactacccaggtgaagtaaacgagtc tgatcatggaaattatggtgcatcagctcattcagattatggaatgataa ctcttctagcaacagatggcactcctggcttgcagatatgcagggagaag gataggcatccccagctctgggaagatgttcgtcatgttgatgggaccct tattgttaacattggcgatttgctagaaaggtggacaaattgtgttttca gatctacacttcatcgggttgttgcagttggcagagagcgatattctgcg gcttactttctggacccaagacccgatctagtggtgcagtgcttggaaag ctgttgctgcgacgcatatcctccaaggtttccacctatcacggcgggtg actatttgaaagaacgattaagtgccacatacaaataactgaagacagag ttgtatttcctgtaaaatancaatgtgtactatgactgtaaaggtagttg tatttcantac
Download
page-top