Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ703151
Length 848 bp
Fasta Format > whv16n12g13
agagagcactaacccagtacttcgggctcggttccgagactcgccacacc gccacatgggttcctgatccttatggaattgagaccggcaaccaagagaa ggcccctgaaggctatgaggagaaatggctgctcaatattcatgccatcg acacgaggggcgtggccgacaagcctagctgcaccgagtgcaagtgcgac ttctacaatgtcacaattgatgagtatgggcgcacagtctcgaagaacta cactggtgggttgctttgctgctatgatcagacccagtgtcggctcaaag cagggttcaacgccgaggtgcggaaggtgttcttgcagtacaccgtgact tggctcgactggactgatgcggtggtgcctgtcaagatctacatatttga cgttacggataccgctatgctcgacgggactcatgaacactcttgcaagg ttgagtatcaagttgaggaatgcagcgcggaaaaccgagccaacaatgag tgcatccatactaagactaccagagcggtcttgccgcgtggaggagatat cgtgtacagtgttgcacaccagcactctggaggagtcggtgcttctctgc atggccaggatggacgccttctatgtgaatcgcttccaacttacggcaca gggaaggaggcagggaacgaggcaaactacattgtcggcatgtcgagttg ctaccctaagccaggatccatcaaggtcancgacggcgaggtgctgacca tcgtctccaactacagcagcgaccgagagcacaccggcgtcatgggcctg gtctacatcctcntggccgagccgcancagccggctccggcgccatcc
Download
page-top