Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ706921
Length 770 bp
Fasta Format > whv16n8d07
taggaccggaatcctatgatgttatcccatgctaatgtatccagagcgat ggcttgctttgagcactctaatttcttcaaagtaacgatgccggaaacac gacccggccaattaaggctaggagcgcgatgccggccgaagggtcgagta ggtcggtgctcgccgtgaggcggaccggccgacccggcccaaggtccaac tacgagctttttaactgcaacaacttaaatatacgctattggagctggaa ttaccgcggctgctggcaccagacttgccctccaatggatcctcgttaag ggatttagattgtactcattccaattaccagacactaatgcgcccggtat tgttatttattgtcactacctccccgtgtcaggattgggtaatttgcgcg cctgctgccttccttggatgtggtagccgtttctcaggctccctctccgg aatcgaaccctaattctccgtcacccgtcaccaccatggtaggcccctat cctaccatcgaaagttgatagggcagaaatttgaatgatgcgtcgccggc acgaaggccgtgcgatccgtcgagttatcatgaatcatcggatcagcgag cagagcccgcgtcagccttttatctaataaatgcgcccctcccagaagtc ggggtttgttgcacgtattagctctagaattactacggttatccgagtag cacgtaccatcaaacaaactataactgatttaatgagccattcgcagttt cacagttcaaattggttcat
Download
page-top