Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ706663
Length 748 bp
Fasta Format > whv16n7b14
tgcccgaccatcgacggcggcgtcgactccttccccttcaaggccggcaa gtacgagatgaagaagttctgcctggagcccacctccttcaccgtcaagg ccgagggcatccagaagaacgagccgccggccttccagaagaccaagctc atgacccgtctcacctacacccttgacgagatggaaggcccgctcgaggt cggcgccgacggcaccctcaagttcgaggagaaggacggcatcgactacg cggccgtcaccgtgcagctccccggaggcgagcgcgtgcccttcctcttc accgtcaagcagctcgtcgccaccggcaagcccgagagcttcagcgggcc cttcctcgtgcccagctacaggggttcgtctttcctcgacccaaagggcc gtggtggctctactggctacgacaacgccgtggcgctacccgccggaggc agaggagacgaggaggagttggccaaggagaacgtgaagaacgcgtcctc ctccacgggcaacatcacgctcancgtcaccaagagcaagccggagaccg gcgaggtgatcggcgtcttcnagagcgtgcagccgtcagacaccgacctc ngcgccaaggcgcccaaggatgtcaagatccanggtgtgtggtacgcnca nctcgagtctaactanagcanancanaagtgaanatactcatcttgtgtg catgcgtacntgggttgatcggtgganangaaacaatcnaggcaacaa
Download
page-top