Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ706606
Length 663 bp
Fasta Format > whv16n6n19
ctcggcgccgccggattcatcatccccgaggcgctcaacaagttcggcgc aaactgcggtcccgaggccgtttggttcaagactggcgcccttctccttg acggcaacaccctcaactacttcggcaacagcatccccatcaacctgatc ctcgccgtcgtcgccgaggtcgtcctcgtcggaggcgccgagtactacag gatcaccaacggactggaatttgatgacaagctccaccccggtggcccat tcgacccgctcggcctcgccaccgaccccgaccaggcggcgctgctcaag gtgaaggagatcaagaacggacggctggccatgttctccatgctgggctt cttcatccaggcctacgtcaccggcgagggcccctttgagaacctgtgcg cgcacctcagcgaccccttcggcaacaacctgctcaccgtcatctccggc gccgccgagagggtgcccagcctgtgagctggccgttgattgcccgtccg ccgccgtcggctgttgatggatcagctgcgtgcgatgcgcgcgatgcagc atcatgtgctgtgtgaattttaccggggaaaagtatgagagtacgaatgt gccgtacgtgtaaattatcaagggcagaagaaacatgatcgttctgattt ctgaaaaaaaaaa
Download
page-top