Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ706247
Length 752 bp
Fasta Format > whv16n5e09
gtctcacctacacccttgacgagatggaaggcccgctcgaggtcggcgcc gacggcaccctcaagttcgaggagaaggacggcatcgactacgcggccgt caccgtgcagctccccggaggcgagcgcgtgcccttcctcttcaccgtca agcagctcgtcgccaccggcaagcccgagagcttcagcgggcccttcctc gtgcccagctacaggggttcgtctttcctcgacccaaagggccgtggtgg ctctactggctacgacaacgccgtggcgctacccgccggaggcagaggag acgaggaggagttggccaaggagaacgtgaagaacgcgtcctcctccacg ggcaacatcacgctcagcgtcaccaagagcaagccggagaccggcgaggt gatcggcgtcttcgagagcgtgcagccgtcagacaccgacctcggcgcca aggcgcccaaggatgtcaagatccagggtgtgtggtacgcgcagctcgag tctaactagagcagagcagaagtgaagatactcatcttgtgtgcatgcgt acgtgggttgatcggtggagaggaaacaatcgaggcaacaatgtgtgttt gtgtgtgtatctantaatctaaacccagggtgtcggtttatattttanct tctgttattgtttcttcctcncctactcatgatattgatcccccatgaat gttcacaaaattgtctgtggacactttcttcnttttaccttccttttgat tt
Download
page-top