Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ706131
Length 389 bp
Fasta Format > whv16n4m20
tgagcttgtgaggactcagacccttgtcaagaatgccattgtgcaagttg atgctgcccctttcaagcagtggtacctgactcattatggagtggaaatc ggtaggaanaanaaagctgctgcanctgccaagaaggatgctgctgaggg acaagagtctgaggttgctgctgctgccacagaggaagcaaagaagagca acaatgtccanaggaagcttgagaagcgccagcagggacgtacactggac tctcacattgaggagcagttcagcggtggaaggctgctggcctgcatttc ntctcgccctggacagtgtggcanagctgatgggtacatcctggagggca aggagctggagttctacatgangaagctccanaanaana
Download
page-top