Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705997
Length 347 bp
Fasta Format > whv16n4e19
ggtgcccgcttcgccaagtggcgtgcngtcctcaagatcggcgccacnga gccatcgcagctctccatcgacnagaacgctcagggtctggctcgctatg ccatcatctgccaggagaatggtctggtgcccattgtggagcctgagatc cttgttgatggacctcatgacattgaccgctgtgcttacgtcaccgagat cgtccttgctgcctgctataaggccctcaacgaccagcatgtcctcctcg agggcactctcctgaagcccaacatggtcacccctggttctgactccnag aaggtggcccctgaggtgattgntgagtacaccgtccgcaccctcca
Download
page-top