Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705870
Length 593 bp
Fasta Format > whv16n3l18
atggcagcccagggtcttctctctgggaggcagctgctggggaggcctct gcagtcctccatctccaggtcgtcttcctcccggaagtcccccttcgtcg tcagggcatcgtccagcccccctgccaagcaaaatgacaacaggcagctg tggttcgcgtccaagcagtccctcacctacctcgacggcacgctgcccgg tgactttggtttcgaccccttggggctgtccgacccggagggcaccggcg ggttcatcgagcccaggtggctggcctacggcgagatcttcaacggccgg acggcgatgatgggggtggtgggcatgatcgccccggaggccctgggcaa ggtgggcctggtgcccccgganacngcnatcccgtggttccangcangcn cgatcccnccngngggcacctaccantactgggccnacccatacacnctc ttcntgttcnanatggnnctcatcnncttcncnnancancnnnnnntcca ngantgntacaanccnnnntccatgnnnaancantanttcntgnnncttn anaantanctnnnnnnntccnnnnannncnnntannnnnnnnn
Download
page-top