Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705745
Length 837 bp
Fasta Format > whv16n3d10
gatttgctcncgatggatctagggtttcggggcgcgggatggccgacgac gacagcgggagcccccggggcggcggcggggtcanggagcaggaccgctt cctccccatcgccaacatcagtccgcatcatgaagaaggccgtgccggcc aacggcnagatcgccnaggacnccnaggagaccctccaggagtgcgtctc cgagttcatctccttcgtcaccagcgaggccancgactagtgccagaagg agaagcgcaagaccatcaacggggacgatctgctctgggccatggccacg ctcggattcgaggagtacgtagaccccctcaagatctacctgcaaaagta cagagatatggagggtgatagtaaattgacctcnaaatctggtgaaggat ccgtgaagaaagatataattggtgctcatagtggtgcgactagctcaaac gcccaagcgatggttcancatggagcttacgcccaagggatgggttatat gcaaccccagtaccataatggggacacctgaaactgaagatcaggcaatt ttcggcaatgggtattgctccatgagtggttatctatctgttaaggaagc cgccccaacattaggttcatgatgatcattggctggaaactaaagcacct ggaagggtgcttaacagttggttgtgatggctgcctccaagatgtaaatt gcttccgagagaatanattcacctattatggtttantgcttgtttttatc tgtacattcanaataattcanccgttggtantttgggcaatcttttgttt canatatttgtattangaancataaatatattacaac
Download
page-top