Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705690
Length 817 bp
Fasta Format > whv16n2p15
attcatggaggaaacatgtttaggcaagagcgcagcacattggtcaacag aactgatgatttttacaacacaaatctctcgttaggaaggccaagcagtt tccgtggaaaagaaaatgtaccaccaaagaggattgtccaaccaagcagg taccgtagctcactatacggctgcagtgagaggggccaaataatgccaca tgagagaaagatgtatgagaacataacatccttggccaatgttgaaggat ccaaacctgcagttttgattgacaaaaccatcgccacatttggacagttg ggtaactcgaagaaaataggtggccgggtccaggcctatgtcataaatgt gtactgcaggcacctatttaatgaaaatcatcctaggaactcactcaagc actatttcttccatactgcatctgaatatttcctgggcaaatggaaaaat gatgaggcaagaatttggtggaggaagaaactgattagaagtttcattgg agctggaaaagcacataatcttttgatgtcagacaagttgtactttccaa cactacacgaggaatattactttctgttcgtcgtcgacatcaagggtcgc acattttattttttggattctttctatgatgagaatagctcatatcatat gaacataaaaaagaagattatctcaagctttatatgcacttggtacgaag ctcggctccagccaatggatttcagtgcattccctactgtttaccctaaa gtccctcaacaagataacgatattgattgtggcattttcactatgaaact aatggggatggtgccca
Download
page-top