Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705653
Length 739 bp
Fasta Format > whv16n2m22
atctgattagttatgtcgtttgtgtacgcgctactgtgttactgtcagat gatccagttaagtttcttttttttttgaactgatccagttcaattttatc atttgcattgcatggngatcagngcaactgttggaccaagctttattaca cgtcgcagtaacctattgttttattaccaanacaactgatgtanagatga gttggngagcagngacttgttaggacggatcaaggtcgacttcaactctg tctggtactctanaattgccaacttctttcagttttatcacacnaatcgg gngcgctatgngngcttcctatacaggacgaggacatatgttataggctt cgtgaatcattatgattctacctctgcaaactgaaatcatgttgatgttg caattgtatggcttccttttcagggctatgctttgttatgngttggttac ccatccnctgatcttgaagttgaaacgcaagatgaanatgaggcaagcaa ttctcttaanacncctaatgaatttctagttcaaatatgctataggaact agtatgaaatattcttctgaattccnatgattgcncgtctatctcaattt gtaggtatattggctccagtttggaaaatactttgcncgggggcctgttg acananatgattacncgctaaancttgcaatgggagacnagtgaaacgtg actgacagcggtacggtttttaagctgcggtttgtaggt
Download
page-top