Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705593
Length 672 bp
Fasta Format > whv16n2j11
tacattaccatgggcccccgccgtgatggcttcctcggctaccaccgtcg cacccttccaggggctcaagtccacagccggtctccccgtcggccgccgc tccagcggcagcctcagcagcgtcagcaatggcggaaggatcaggtgcat gcaggtgtggccaattgagggcatcaagaagttcgagaccctgtcttacc tgccacccctatccacggaggccctcctgaaacaggtcgactacctgatc cgctcaaagtgggtgccctgcctcgagttcagcaaggttggcttcgtctt ccgtgagcacaacagctcccccgggtactacgacggccgatactggacaa tgtggaagctgcctatgttcgggtgcactgacgccacacaggtgctgaac gaggtggaggaggtcaagaaggagtaccctgacgcctatgtccgtgtcat cggcttcgacaacctgcgccaggtgcagtgcgtcagcttcatcgccttta ggccaccgggttgcgaggagtccggcaaggcctaaactacgagttgaaac aatggcctatctcgtatgaaggtcttttgtgaacttcacttttgtccaaa actctgctgtacgactctgctttctgaccggagcataccttttgttctat atgattttgtgtaaaaaaaaaa
Download
page-top