Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ705472
Length 582 bp
Fasta Format > whv16n2c03
ccacgcctgcctcatctctcggagcaggaggaggagcttgcaggaacaat ggcagcccagggtcttctctctgggaggcagctgctggggaggcctctgc agtcctccatctccaggtcgtcttcctcccggaagtcccccttcgtcgtc agggcatcgtccagcccccctgccaagcaaaatgacaacaggcagctgtg gttcgcgtccaagcagtccctcacctacctcgacggcacgctgcccggtg actttggtttcgaccccttggggctgtccgacccggagggcaccggcggg ttcatcgagcccaggtggctggcctacggcgagatcttcaacggccggac ggcgatgatgggggtggtgggcatgatcgccccggangccctgggcaagg tgggcctggtgcccccgganacngcnatcccntggttccangcangnncn atcccnccngnnnncacctaccantactgngncnacccatacacnctctt cntgttcnanatnnnnctcatcnnnttcncnnannaccnnnnnntncang antgntanaanccnnnntcnatnnnnaannan
Download
page-top