Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ596066
Length 863 bp
Fasta Format > rwhsd6o01
atagatagtgatattacatgataaaacaacaaaaataaaagaaatatatc aagccacaagatagcatcaatcaagaaaaatgcgcgggaggaagaaattt agccaagaaacaccgatgactgaaactagtagtggaattcatttgccttc ttgaaaaccccagcttgggcagaagcagcaccatcagaggtcacggccac gacgatacagtccttcacctgctgggtggtaaatgggaacttcttgttca caatggagttgaggtatgcagctgccccctcacgtatcagggcgccaata ccatcagttctagtgtttgagagtgcatcatgcatatttcctagcttctt gccacctatcatactgcatgcagcaccaaatgtcttgccgatgttgccga gggacccaatagctgcaactatagcatctgggtgattcttccagtagtcg caggatccaatgaacccatgcttctttggacttgcagggacatcatggga aggtgcacttggggtgctcggtgtagtgccataagatggcgtcggtgtag tgccgtaagatggcgtcggtgtagtgccgtaagttggcgtcggtgtaatg ccgtaagttggtgtcggtgtagtgccgtaagatggcgtcggtgtagtgcc gtaagttggtgtcggtgtcagtgtcgggttgtancctcctcctgacccat gcgtgggagttggtgagcccccatantgggtcttctgctcatgcaactct cccangctcctgcacnanctcantgaaacaanccccaccaanacggcact catcanaanaaccttgccacccatattgctctcantgtgtgcanacngga canaataancaac
Download
page-top