Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595991
Length 718 bp
Fasta Format > rwhsd6j08
tgtcactggcagttgcttattacgggtaaattggagtaaaaacgaacaaa aacaaggatccctcagcaggagctggcacactcctgctcgtgagcaagtc tcgggcgaacagctgaaacccaaaaaatttaacttgtacagagcggtggt aacacctcgtcatcaggcattctcgctggcgatcttctctgccttggcga tgacttcgtcgatgcctccaaccatgtagaacgcgtgctccgagatgtcg tcgtacttgccgtccaaaacaccctggaaactttggacaccctcctttag gtccacatacttccctggagcaccagtgaaaacttcggcaacatggaaag gctggctcaggaacttctggatcttccttgcacgagcaaccgtcatctta tcatcttcactgagctcatccatacccaaaatggcaatgatatcctgaag attcttgtagttctgaagaaccttctggacaccacgggcagtgttgtagt gatccacacccagaacgtggggagaaagcattcttgatgtcgagtccaag ggatcaacagcagggtaaatgcccagctcagaaatctgtcgtgacaacac agtagtagcgtcaagatgggcaaaggtggtagcaggagcaggatccgtca aatcatcagcaggcacataaatagcctggacggatgtaatagaacccttc tttgtcgtcgtaatccgc
Download
page-top