Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ225923
Length 603 bp
Fasta Format > whdl24g16
gcggcggcggagacgacggaaacatggtgcagcgtctgacctaccggaag aggcacagctatgccaccaagtccaaccagacgcgggtcgtcaagacccc aggtggtaagctcgtgtaccagtacaccaagaagagggcgagcggcccca agtgccctgtgaccgggaagaagatccaggggattccccacctcaggcct actgaatacaaaagatcaaggttgtctaggaaccgcaggactgtgaaccg tccctatggtggagtgctctctggaactgcggtgagggaaaggatcatcc gcgctttcttggttgaggagcagaagatcgtgaagaaggtgttgaaaata cagaagaccaaggacaagacgacctcaaagtaatctgtttgaaacggaag tgcgaagtgagatggtgttctgtaaacaaggaaaatatttttgttggtgg ttatgatcaatggtttagtcccttctagctaaatgttttagagtacttga aatccttctgcccgccgtgacatcagagattgtgaaacatttgataccca tttgcagtttcatttctgaatgcatgttgaatctacttgtgttaaaaaaa aaa
Download
page-top