Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595232
Length 713 bp
Fasta Format > rwhsd3l08
tagtgggttagacatacacatgattcatttacatctctcgattctctctc tagttaggtatagtatactcgccacaccagaagttgtagattacaaactg aaataaaaaccattaccagttcccaggattattacgacaagccatccaac aaaagagcaaagaagaacctttacattatcccgctttcttggtgtcgaaa gtggagtggtggcttagggatccagccttatacacaagtagtaattacaa aggcagtgagagattaaaaacaatcatagtgctcgacgtcaaggcgactt gatggtatgccagtgtcatgaggcacgcaacagttccttgttatagtact aagagtcggccttggcggggcattcgaggctggcgttgaagtggcgggcg gggaacttggcggagacggagcccacctcgaagacgagctcgtctccatc ggcgcggatcccggtgatggaccaccagcggaagaaagccctgacgcgga tgccgctgaggccggagatgcgacggtcgtcgaggtggccggtgaggtgg tcgttgaagttggcgaggtagctccccgccggcagcacgatgcggcagct ggagtcgaggtcgacggcgaagtcccccgagccggcgtcgagcgtgtacc cgcgaacgttggccgggagcaggccgcgcgggaagccgcggaggcggagc tcgtcgtangcgg
Download
page-top