Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ595124
Length 838 bp
Fasta Format > rwhsd3e17
ataatttacatagatatgcacgcccgattaaatcgcgtgcgtagtgcaat acaaaaggaagggaaagtacaactcgcagacttgaacaggtgacgctgcc gacaggcacacacaccgaggaggggaggaacagcacggtagatatagatg attacagcgtgcgcggccgagacatgatccacgtactacgcgcgcgcgag caaccaccaccaccaccacatgatcgatcgaccgacgatgaacagcgata agattccattcgcggctggttgattggtggactagtcgcggctcttgaag gggatggcccggatcaccaccacgtggtagatggccgccagcgccgcgcc gatgaacgggcccacccagaagatccagtggtcgtcccacgcctgcttct tgttgtagatgatggcggcgccgagggacctcgccgggttgatgccggtc cccgtgatggggatcgtcgccaggtgcaccaggaacaccgcgaacccgat cggaagcggcgccaggatggggacgtgagagtctctggcgctgcgcttgg cgtcggtggcggagaagacggtgtacaccagcacgaacgtgccgacgatc tcggcgccgagcccgtcccccttggtgtacccgggcgcgacggagttggc gccgccgccgttgccctggtacagcgtggtctggaaccccttcaccacnc cggcgccgcatatggcgcccangcactgcatcacnatgtanaacacngcc ctggtgancgacancttcctggccangaacancccnaangtgaccncnnn gttnatgtgnccnccnnanatnccnnnnntncantana
Download
page-top