Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594815
Length 930 bp
Fasta Format > rwhsd2c04
aattggagcaagtttgggggtacatatccgttccgttcacataaacatgc gcggcattattgctcaatcctaagagcttcaaccagagttcattccggag gttaaacacacccattttcacaaaaactcgcgaagataccgtctagtagg gctccaccggtgcgcggaacttgaggccagcatacactgcagcgtcgccc agctcctcctcgatcctcagaagctggttgtacttggcaagacgctctga ccggcagggagccccggtcttgatctgacccgtggacagaccaacagcca aatcagcaatgaatgtgtcctcggtctcaccactcctgtggctggtcatg acaccccagccagcatgttttgacatcttcacggcctcgatactctcagt gacggatccaatttggttaaccttcagcagaagagcattgcatgacttct cctggattgccttcgcaactctggttgggttggtgactagaaggtcatca ccaacaatctgaacttccactccacattcttcagtcatcttagcatagtg cacccagtcatcctggtcaaatgggtcctcaatcgacacaatggggtact cactcacaaatgacttgtatacgttcttcaggctatctccagatatcttc tgagaaccatcattgttctcctccttgaagttgaggtcataggttttgtc cttgtcattgtagaactctgaagcagcaacatccattccaatgacaacct tgccggtgtatccagccttttcaattgcagtcttcaagagctcaaggccc tccttattctcctgaatgttaggagcaaaaccaccttcatctccgacatt ggtggcatccntgcccgtacttcttcttgataacanacttcaagttgtgg gtacacttcaacacccatcttcattgcctc
Download
page-top