Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ594547
Length 449 bp
Fasta Format > rwhsd20b14
catgggggatcaatatcatgagtaggcgaggaagaaacaataacagaagc taaaatataaaccgacaccctgggtttagattactagatacacacacaaa cacacattgttgcctcgattgtttcctctccaccgatcaacccacgtacg catgcacacaagatgagtatcttcacttctgctctgctctagttagactc gagctgcgcgtaccacacaccctggatcttgacatccttgggcgccttgg cgccgaggtcggtgtctgacggctgcacgctctcgaagacgccgatcacc tcgccggtctccggcttgctcttggtgacgctgagcgtgatgttgcccgt ggaggaggacgcgttcttcacgttctccttggccaactcctcctcgtctc ctctgcctccggcgggtagcgccacggcgttgtcgtagccagtagagcc
Download
page-top